All You Need To Know About Corporate Health Insurance

When an employer offers benefits to his employees, the latter feels a strong sense of belonging and gives their best. Group health insurance is a form of corporate insurance, which typically covers the medical expenses of a team of people who are employees of a common company, members of certain so is tied or professionals belonging to a common group. Such a corporate insurance coverage enables organizations to attract and retain talented manpower. Irrespective of whether you in a big company or a small business, it becomes simpler to retain the most talented people in your industry by offer g them a good health insurance plan.

A majority of health insurance companies provide flexible plans at reasonable rates of premium. However, the premium charged will depend on various factors such as the group size, profile of the employees and so on. The policy operates under a set of terms and conditions that are applicable to the insured employees. Healthcare costs have been increasing at an alarming rate making it absolutely essential for all employers to offer coverage to the employees as well as their family members from situations related to financial instability, which may happen when the employee has to be hospitalized.

Merits of corporate healthcare insurance policy

For any company, the most treasured resource is none other than its employees. Today, a large number of companies are becoming highly employee-centric. Corporate health coverage has evolved as a highly popular form of employee benefits to attract new talent. Thus, this insurance plan has an important part to play to influence an employee’s psychology. Such a policy can make an employee feel that they have an important part of the company where he works. Corporate health plans Los help in reducing the attrition rate of employees and reduce turmoil in trade unions of the company. Plus, it also helps in increasing the productivity of the workers leading to business profitability. There are certain insurance products where the employees’ families are also provided coverage making these employees loyal towards the company they work for. Additionally, when an employer offers health coverage to his her employees, they get eligibility for tax deductions.

Key characteristics of corporate health insurance policy

While there are many corporate of group health insurance coverage available, here are some of their common attributes that you should be aware of.

Insurers of group health insurance products ideally offer coverage for medical or health benefits of the insured as well as for the spouse, kids as well as dependent patents.

Corporate health insurance policies offer facilities like cashless hospitalization in their network hospitals.

There are some insurers who also cover maternity and pre-existing health expenses.

Such health insurance policies may also cover ancillary expenses such as expenses to hire ambulances.

Also, it is good companies also known as contractors all risk insurance protects both workers and dangers to company property during say a project.

There are some health policies, which cover reimbursements for consultation fees of specialists as well as fees for other practitioners where you may visit for a follow-up checkup.

Final takeaway

It is indeed an open secret that all employees understand the immense value of being a member of a group health insurance value. It is a wine in situation for both employers as well as employees as both of them benefit. but since premium rates are increasing at an alarming rate and you may be very busy with operational functions as the owner of the company. It is tough to spare the necessary time to study the available products at length before deciding the final product. A reputable corporate insurance agent can help you in making the right choice and eventually purchase a good health insurance plan for your staffs.

Riveting facts about DNA Mapping

What is a genome map or DNA map?

A genome mapping or DNA mapping involves landmarks that usually are short sequences. DNA map and sequence are completely different. A map includes the series of landmarks while a sequence describes that DNA base in a clear fashion. In a nutshell, a genome map only shows the start, connecting and end landmarks that actually connect the sequence while a sequence shows every single detail of the DNA base. For example, GCCTAGCGAAGTCCAGCCTTACCG is the sequence while GCC——AGT———CCG denotes the DNA map involving three landmarks GCC, AGT and CCG. So, genome map creation for any human takes lesser time than sequence creation due to its lesser information and complexity.

Why is a genome map created?

Genome sequence is just a string of letters A, T, C, and G in a random fashion. To create a pattern and to differentiate each set from the other in a sequence, the genome map is created. Landmarks help in this differentiation which is of great aid to the scientists in segregating the necessary information from the redundant in the whole gene sequence. Gene map can also help sequencing in a certain way. If there are clones in the map that resemble each other, then they can be sequenced based on the pattern followed by that clone.

How is DNA mapping performed?

The first step involved in DNA mapping is to collect the samples of tissue from the person who needs to be tested. Then, the next step is isolating a gene and checking for its connections to a particular disease or disorder. This is done with the aid of DNA markers. These markers locate the gene which is infected. A collection of DNA markers on a genetic map shows that one among them reveals where the infected gene is present.

Benefits of DNA mapping:

Every human has a different structure of genetic arrangement. Each genetic structure denotes different data. Genes can convey a lot of information regarding a persons talents, skills, characteristics, sensitivity to certain foods, susceptibility to diseases and much more. Genetic tests involve the concept of DNA mapping to find the set of genes which are the reason behind occurrence of a disease and also set of genes that display a particular skill or ability. DNA mapping is used for various tests that would be of utmost benefit to any person by determining a lot of qualities. There are two genetic tests developed by Map my Gene namely Inborn Talent Genetic Test (ITGT) and Disease Susceptibility Gene Test (DSGT). ITGT is created for newborn kids whose hidden abilities and skills can be recognized at an early age itself. It would be of great advantage knowing what your children like and dislike in their childhood only. Besides this information, susceptibility to diseases can also be found by this test. If your child is prone to a disease due to inheritance, the reason due to it can be found and the disease can be cured too. ITGT can be of utmost benefit because it produces a complete list of around 46 traits including the ratings against each trait.

The other genetic test is DSGT which is primarily conducted to explore the diseases a person is highly susceptible to. Around 100 diseases can be detected by this test and in case if you are vulnerable to a particular disease, guidance in curing it is also provided by the medical experts of Map my Gene. The reason behind the vulnerability to a disease can also be known after taking this test. By knowing the potential risks of getting a disease well prior will highly reduce the chances of passing it on to your offspring. A healthy lifestyle can be maintained by people who take this test and can also save lots of money which needs be spent for curing it.

DNA mapping has a lot of benefits and few of them were listed here. Take a wise decision on choosing the best DNA testing method by referring to Map my Gene and stay healthy!

Many gifted children had to go through this test in hope to discover the secret in their DNA and gave them their intelligence.

All about Inborn talent genetic test

 

 

Genetic testing or DNA testing is a tool to ascertain of a person is carrying a certain genetic condition, which has a chance to lead to a medical condition later on. The testing diagnoses alterations in the proteins, chromosomes and the genes that could lead to a certain genetic condition. DNA testing is usually used for the risk assessment of developing some inherited disorders or the existence of certain abnormalities. Results of these tests can then be deployed to ascertain the potential of a person to succumb to certain inherited disorder as well as the chances of a parent to pass on that disorder to their offspring.

Today, the market is full of hundreds of different types of genetic tests with new and innovative tests emerging on every other day. Genetic testing tidally uses a blood sample that is then analyzed in detail. The sample constitutes of DNA that is analyzed thoroughly to watch out for mutations.

Although direct-to-consumer is one of the most rapidly growing genetic testing industries, it has also been a controversial one. However, its supporters will vouch for the immense benefits offered by this tool that offers the customers an ability to familiarize themselves with their genomes. The good news is that there is no need for a genetic counselor or a medical professional to involve or intervene. Today, it is the world of personalized medicines based on testing and is highly demanded in various hospitals and clinics.

Inborn talent genetic test

The tests assist the parents to find out hidden talents of their kids, which may not be otherwise detected at an early age. The test also unveils certain special personality traits, which a kid may have, judging from their genetic make-up.

You all know that knowledge makes one very powerful so when the hidden identified many gifted kids , it becomes simpler for you to be I control and ensure that the development of the child is maximized to utilize his or her complete potential. The results of the tests will enable you to understand the areas where your kid need to focus more on his or her development. You can try your best to unleash your child’s potential and are able to intervene at a nascent phase for taking care of potential problems that your kids may face before they go out of control.

When you build a powerful foundation at a very early age, you are actually giving your little one a bigger opportunity for being successful in life. The test result also highlights an assessment done on career profiling based on the unique abilities and talents of your offspring that is unveiled by the DNA test. The profile is used as it offers a balanced career and educational guidance to your kid.

Inborn talent genetic test- merits

You can put the best possible efforts and utilize all your resources and time in the best possible manner so that the gifted areas of your kid can be developed at an early stage. Plus, it is possible to maximize the potential of your little one and get a high return on the investments made by you.

You can know about the personality traits and the innate talents of your kid. Accordingly, it becomes easier to choose the most effective development program since you know what he or she is inclined towards

To give a head-start to your child and then plan for the future of your child more efficiently as well as effectively

You can intervene quickly to sort out potential concerns that your child could be raving so that they are easier to reverse

A good device provider ensures that there are expert in-house consultants who provide consultation sessions after the test. They will give their suggestions and recommendations on the career and talent development of the kids.

You will also get an assessment on his or her career profiling based on the unique talents of your kid that came out from the genetic test.

Select the right college for the right kind of education

Adopt effective child discipline by tailoring your discipline strategies to your childs personality

Top Merits of Genetic Testing

Benefits of genetic testing

As mentioned before, genetic testing offers a host of great benefits. So know these benefits well and how far they are applicable to you before you can take a call you plan to have babies in the future.

Can unveil the genetic makeup of your child or you

A DNA test gives you certain sure shot data about your kid’s or your genetic makeup. It is extremely important for some people to get a relief from uncertainty although the news may not be good. On the other hand, in case it is good news like a mild prognosis, there is a deep sense of relief within you.

Helps in detecting a genetic condition

Such a test is also useful in diagnosing a certain genetic condition. The moment an accurate diagnosis can be made for a person, it becomes easier to get an appropriate and the best possible treatment to cure the condition he or she is suffering from. For instance, in case a genetic test tells a woman that there is a high degree of possibility for her to develop a condition like breast cancer, she can visit a clinic more frequently for her checkups. The woman can also take other actions so that so such a risk of becomes negligible.

Provides information while planning for future babies

These test results can also give you valuable information if you plan to have kids in the future. For example, when your spouse and you are aware of the possibility of having a kid with a certain genetic condition, then you can test your unborn fancy during your pregnancy to find out whether it is affected or not. Additionally, when you are aware of a high potential of having a kid with a specific genetic condition, you get a chance to become more practical as well as mentally prepared.

Newborn screening can help in early treatment

Genetic test help in newborn screening that can help in identification of genetic disorders if any at quite an early stage. Thus, parents of the newborn can start their baby’s treatment as quickly as possible.

Since genetic conditions are found to run in a family very often, knowledge about a person’s genetic makeup can be if a great help to his or her other family members. When the family members know that there is certain genetic condition that runs in their family, the knowledge can help them to prevent any type of misdiagnosis

Lastly, going for genetic testing can identify gifted kids early so that their talents can discovered early and nurtured.

How your business success has strong links with the health insurance plan you provide to your employees

Why do you, as a business owner, ensure to offer various types of benefits to your employees? The answer to this question is that you want your employees to know that you are interested in their welfare. But why are you interested in the well-being of your employees? The reason is that you want them to perform to their fullest potential so you can achieve the business success you are aiming at more quickly.

During the course of conducting your business, you may have to buy a number of corporate insurance plans. Buying an appropriate health insurance plan for your employees is as important as or rather, more important than shopping around for other corporate plans because you will derive immense benefits by putting in place a health insurance cover in your company. Let us now look at some of the other benefits you will derive by taking this step.

1. An excellent health insurance plan will attract great talents

Job aspirants and especially, highly talented people, mainly look at the health cover you have put in place in your company. The reason is without such a cover, they cannot enjoy the fruits of their remuneration fully. Nowadays, medical expenses are sky-rocketing and if the employees or their family members happen to fall ill, they may have to spend heavily on their own in the absence of a suitable health cover. That is why they give more importance to this benefit than to other perks and benefits. In fact, studies reveal that if you put in place a good health insurance plan in your company, you have a better chance of attracting top talents to your company than your competitors.

2. You are removing the stress from the minds of your employees

If you do not offer a suitable health cover to your employees, they may have to look for insurance plans themselves. This is not an easy task given the fact that there are a number of plans and providers. They may have to spend considerable time and do a lot of research to zero in on the right plan. This may certainly cause stress to them. By putting in place a suitable group health plan in your company, you are saving your employees from the onslaught of this stress.

3. Retaining top talents is easy

Since the highly talented employees who join your establishment are happy with the health insurance plan you have put in place, they may not like to leave the company. Such loyal employees can do a lot of good for your company’s growth. Apart from turning out optimized performance day in and day out, they will ensure to take all possible steps for satisfying your customers also because they are aware that unless customers are fully satisfied, the company will not grow. In other words, their career growth also hinges on client satisfaction and hence, they will make all possible efforts to achieve this aim.

3. A good health insurance plan is good for the finances of your employees

Since you have put in place a suitable group plan in your company, employees need not spend money from their wallet for their medical expenses. So, this is good for their financial health as well.

4. A group plan will help in team building

Since your group plan will cover all the employees, they will feel united. In a group plan, every employee contributes to the health and welfare of every other employee. This will give your employees a sense of satisfaction and accomplishment which will do a world of good in infusing team spirit in your employees.

5. An appropriate group cover will reduce absenteeism

Another factor is also product liability insurance since employees do not have to fear customers making a claim against them for any damages caused by the product sold.

Thanks to the group health insurance cover you have put in place, employees will feel healthy and so, absenteeism will get reduced to a significant extent. So, the work-flow in the company will not get impeded. So, productivity of your company will increase manifold and this will accelerate your business success.

Benefits and Possible Risks of DNA Testing

Genetic testing has made a lot of progress in the last few years and it has also become easier for people to reap the benefits of this technique. However, it is important that everyone is well versed with the benefits as well as the drawbacks of making the choice to get your DNA tested.

Benefits of DNA Testing

There are various reasons why it is beneficial for you to get your DNA tested that will help you in your present as well as your future.

Genetic testing can help in the diagnosis of different chronic diseases. It can either be a current medical condition that the person is suffering from that can either be caused due to a genetic defect that was not previously known or can have another genetic component.

It can also be used to detect the possibility of a previously healthy individual later developing a disease such as Alzheimers. Individuals who have a family history of this disease can benefit from getting this test done so that they can take the required precautions for the disease.

A DNA test can also help to determine if an individual has certain alleles in their genome that would require them to make certain changes in their lifestyle or their environment. For example, doing whole genome sequencing can help to indicate the possibility of the individual developing type 2 diabetes. With this knowledge, the individual can make the required changes in his or her lifestyle that can help to prevent or control diabetes.

DNA testing can also be done so as to prepare a tailor made treatment for a disease that the individual is suffering from. The genetic map of the individual can help the doctors to choose the best possible course of treatment for that disease. This individualistic approach can help to get quicker results and also reduce the chances of the patient getting the wrong treatment by mistake.

In the case of children getting a DNA test done can help to calm the parents from uncertainty even in cases where the result is not very good. The parents are then able to make informed decisions about what would be best for their child.

In cases where you or your partner or both are susceptible to a certain genetic disorder, it is easier to test whether your child will suffer from the same disorder in the womb. This will help you to be more prepared both mentally as well as practically when the child is born.

Risks of process of Dna profiling is used to bring out

Although the benefits outshine the risks many folds it is important that you are aware of them before you choose to get your DNA tested.

The whole process of the DNA testing can be a rollercoaster ride of emotions. You can go through a list of mixed feelings such as fear, anxiety, guilt, or relief. You will also have to think about the consequences that you and your family will face in case of either good or bad result.

Some of the genetic mutations that cause problems in life may not be easily identifiable and it can be a very frustrating process if this is the case.

Another risk maybe finding out that you are or can suffer from a life threatening condition but there may not be any treatment for it known to us.

Just the presence of a mutated gene cannot show the severity of the disease in that particular individual.

Most importantly once you get the results of your DNA test there is no way to undo it or to unsee the results. So be very sure that it is something that you want to do and want to know about yourself before going ahead.

Source

https://ghr.nlm.nih.gov/primer/testing/benefits

http://www.impact-study.co.uk/public/geneticsandcancer/genetictesting/positiveandnegativeaspects

http://knowgenetics.org/genetic-testing-of-adults/

http://www.geneticalliance.org.uk/information/services-and-testing/benefits-and-risks-of-genetic-testing/